DESMONTANDO A LOS IMBÉCILES CON MUCHO RIGOR CIENTÍFICO (PARTE 5). - KW77 COMUNICACIÓN

Última hora

billboard

Post Top Ad

martes, 25 de agosto de 2020

DESMONTANDO A LOS IMBÉCILES CON MUCHO RIGOR CIENTÍFICO (PARTE 5).

KW77 INFORMA: 
DESMONTANDO A LOS IMBÉCILES CON MUCHO RIGOR CIENTÍFICO (PARTE 5).

Como me llamo Juan Manuel Jiménez que hoy explico yo la PCR. Aunque me cueste la vida. Y es un tema muy difícil, no os vayáis a creer. Pero os aseguro que lo haré tan facilito que incluso los Seres de Luz me lo van a comprender. Y si no, que se me seque la yerbabuena.

Los cuatro productos químicos más bellos del Universo son la Adenina, la Timina, la Guanina y la Citosina. Nunca olvides sus nombres, lector: todo lo que tú eres se lo debes a esos cuatro. Tus ojos azules, tu habilidad para las matemáticas, tu nariz chata, tu voz aguda, tus dos brazos en su sitio… todo se lo debes a la adenina, a la timina, a la guanina y a la citosina. Se llaman nucleótidos, y forman las cadenas de ADN y ARN que contienen la información al completo de lo que es Miguel Bosé, de lo que fue Elizabeth Taylor, de lo que es una serpiente, de lo que es un champiñón, de lo que es una bacteria, de lo que es un oso polar, de lo que es un sauce llorón, de lo que es el virus de la gripe, de lo que es un alga marina, de lo que fue don Albert Einstein, de lo que es el algodón… y de lo que es un coronavirus. 

Esos cuatro productos químicos, esos cuatro ladrillos del libro de instrucciones de la vida, son los objetos más maravillosos que ha creado Dios, o Alá, o Jehová. Lo digo para los creyentes. Para quienes no lo somos… son los más maravillosos que ha creado la Naturaleza. Nunca te olvides de ellos, lector. A partir de ahora los nombraremos por sus letras iniciales: ATGC. Y verás tú cómo me sale algún listo diciendo que se me olvidó el uracilo.

¿Cómo dan las instrucciones esas cuatro maravillas para formar un ser vivo? Fácil. Se unen en cadenas aleatorias y se leen de tres en  tres. Cada grupo es una ORDEN a ejecutar. Verás qué fácil:

AGC-TTC-CGG-CTA: esa orden significa “Futura señora Encarna: fabrique usted dos piernas ahora mismo para poder caminar”.

CAA-GCT-ACC-GAT: esa orden significa “Futuro señor elefante, fabrique usted una trompa ahora mismito para poder beber y alimentarse”.

AGG-CCC-GGT-ATA: esa orden significa “Amigo Miguel Bosé, te vas a quedar calvo en tu madurez. Fuera pelo”.

TGT-TCC-CAT-CGT: esa orden significa “Señor sapo: fabrique usted un veneno en la piel para defenderse de los depredadores”.

AAG-TGC-AGG-CAG: esa orden significa “Señor olivo: fabrique usted este otoño las mejores aceitunas de Andalucía (que, por cierto, son las de Sedella y las de Canillas de Aceituno. Como todo el mundo sabe)”.

¿Ves qué fácil, lector? Pues así todo.

Hay en la Naturaleza una secuencia concreta de casi 200 nucleótidos que nos interesa muchísimo ahora. Son instrucciones precisas que podrían comenzar de esta manera: AACGTGGCATGCCGTTATGCATTTCCGGACAAT… que quiere decir lo siguiente: “eres un coronavirus cabrón que te vas a introducir en las células humanas para generar una pandemia y joder la economía”. Bueno. Chispa más o chispa menos. Pero creo que se me entiende.

El caso es que, gracias al método científico y a los avances genéticos del último siglo, tenemos lo que nunca habíamos tenido: un aparatito que lee las cadenas de nucleótidos como si fuese el periódico y, por tanto, descifra su significado. Y no sé a qué viene dudar sobre este hecho incontestable. Hace años que leemos “órdenes” del tipo: “este niño va a ser hemofílico”, o “este niño va a tener fibrosis quística”, y damos consejo prenatal a los padres. Pues con los virus, igual. Sabemos leer secuencias de nucleótidos que dicen “soy un cabrón coronavirus que me voy a introducir en las células humanas para generar una pandemia”. Y punto. Y el que no se lo crea… que se vaya a sembrar nabos a la Edad Media.

La técnica que poseemos para leer estas órdenes genéticas se denomina PCR. En el caso del coronavirus se realiza tomando muestras de la nariz y la garganta con un hisopo. Luego se manda el hisopo al laboratorio y… ¡tachaaaaán!: el resultado.

Bien. Ahora hablaré de los resultados de la PCR. Pero antes, un inciso. 

Todos sabemos que cuando una bacteria o un virus nos contagia, el cuerpo reacciona produciendo DEFENSAS. Esas defensas se llaman anticuerpos. Para simplificar las denominaremos IgM e IgG, y están presentes en la SANGRE. Quiero decir que sólo un análisis de sangre las detecta. Nada que ver con la técnica PCR. De esto no tiene duda ni Miguel Bosé.

A las pocas horas de un contagio por coronavirus aparece la IgM en sangre. Días después ya encontramos en sangre IgM e IgG. Días más tarde ya sólo nos queda la IgG. Y esta IgG, que protege de nuevas infecciones, permanece circulando incluso cuando ya no tenemos el virus. Hay pacientes que ya llevan seis meses con la IgG positiva. Curados, por supuesto. No contagiosos, por supuesto. Protegidos de nuevas infecciones, por supuesto. Pero ignoramos si esto será para siempre o sólo por un tiempo más o menos largo. No se sabe todavía.

De modo que, a modo de recapitulación, estas son las distintas posibilidades de los resultados analíticos combinados según el momento de las pruebas. Y hago referencia, ahora, a la secuencia más habitual en la infección por coronavirus. Mañana, con el ejemplo práctico de Juanito Pérez Pérez (un cabroncete de 25 años que se va de botellón) comentaremos las excepciones: los falsos positivos, los falsos negativos, la indicación de la prueba, la actuación ante los contactos de Juanito y cosas así:

a-Momento Cero: el coronavirus entra en las fosas nasales y en la garganta de Miguel Bosé. Ningún síntoma tiene, aunque ya puede contagiar a otros sólo con su respiración. No te digo nada si canta en un escenario sin saber que porta el virus. Nada de esperar a que tenga tos y estornudos para contagiar, como afirman los médicos medievalistas de la desgraciada asociación para la “verdad”. Los asintomáticos contagian. Incluso Miguel Bosé. 

b-Momento 1: Bosé se encuentra un poco cansado, pierde el olfato, le duele la garganta, tiene algo de tos seca… Entonces se sospecha que pueda estar contagiado. La PCR (muestra de material viral tomada de la nariz y la garganta) es positiva, y en la analítica de sangre aparecen anticuerpos (defensas) tipo IgM. ¡Sólo IgM!

c-Momento 2: pocos días más tarde Miguel ha mejorado. La PCR sigue siendo positiva (sigue habiendo virus; sigue contagiando). En la analítica de sangre aparecen defensas de tipo IgM e IgG.

d-Momento 3: han pasado dos semanas. Miguel Bosé está casi totalmente recuperado. La PCR ya es negativa (no hay virus; ya no contagia). En la analítica de sangre, las defensas tipo IgM son casi indetectables, pero la IgG alcanza valores notables. 

e-Momento 4: han pasado varios meses desde que Bosé se contagió. PCR negativa. En sangre, IgM negativa e IgG positiva (paciente sano y protegido).

Bueno. Hasta aquí la clase. No sé vosotros, pero yo me encuentro muy satisfecho con mi disertación de hoy. De hecho, creo que no se me va a secar la yerbabuena.

Cagoentó y hasta mañana. Nos espera el tal Juanito Pérez Pérez, que va a volver loco a su médico de cabecera por asistir a un botellón. Veréis qué risa. 

Ah. Se me olvidaba. Mucho cuidado si recibís un archivo cerrado diciendo que son entradas gratis para un concierto de Miguel Bosé. No lo abráis. Podrían ser entradas gratis para un concierto de Miguel Bosé.

Firmado:

Juan Manuel Jiménez Muñoz.
Médico y escritor malagueño.


-SI QUIERES PERMANECER INFORMADO PUEDES UNIRTE A NUESTRO CANAL DE TELEGRAM DESDE EL SIGUIENTE ENLACE: Canal Telegram de Noticias de Lorca, Región de Murcia y España https://t.me/kw77comunicacion TAMBIEN PUEDES DESGARGAR NUESTRA APP DESDE LA PLAY STORE DE GOOGLE BUSCANDO KW77 RADIO. CONTENIDO RECOMENDADO:

No hay comentarios:

Publicar un comentario

Post Bottom Ad

¿Puedes ayudarnos a mantenerte informado?
KW77 COMUNICACIÓN se financia mediante  donaciones u aportaciones de nuestros socios y gente desinteresada como tú.
No recibimos ayudas, ni subvenciones, ni tenemos detrás ningún lobby o grupo de comunicación que costee nuestra actividad. Por ello practicamos el periodismo libre. AYÚDANOS A SEGUIR SIENDO LIBRES haciendo tu aportación. Gracias.    

Pages